Artificial Intelligence (AI) Calculator for “Codon and translated protein calculator”
Understanding the relationship between codons and their translated proteins is fundamental in molecular biology. This calculator converts nucleotide sequences into corresponding amino acid chains efficiently.
In this article, we explore codon-to-protein translation, provide extensive codon tables, formulas, and real-world application examples. Dive deep into the mechanics of genetic code translation.
- ¡Hola! ¿En qué cálculo, conversión o pregunta puedo ayudarte?
Example User Prompts for Codon and Translated Protein Calculator
- Translate the DNA sequence “ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG” into its protein sequence.
- Calculate the amino acid sequence for the mRNA codons “AUG UUU GGC UAA”.
- Determine the protein product from the codon sequence “UUU GCU UAC GGA”.
- Find the translated protein for the DNA codon “TAC GGA TTT CGA”.
Comprehensive Codon Table: Mapping Codons to Amino Acids
| Codon (mRNA) | Amino Acid | Abbreviation | Properties | Frequency in Human Genes (%) |
|---|---|---|---|---|
| UUU, UUC | Phenylalanine | Phe (F) | Nonpolar, aromatic | 3.9 |
| UUA, UUG, CUU, CUC, CUA, CUG | Leucine | Leu (L) | Nonpolar, aliphatic | 9.1 |
| AUU, AUC, AUA | Isoleucine | Ile (I) | Nonpolar, aliphatic | 5.3 |
| AUG | Methionine (Start) | Met (M) | Nonpolar, sulfur-containing | 2.4 |
| GUU, GUC, GUA, GUG | Valine | Val (V) | Nonpolar, aliphatic | 6.6 |
| UCU, UCC, UCA, UCG, AGU, AGC | Serine | Ser (S) | Polar, uncharged | 6.9 |
| CCU, CCC, CCA, CCG | Proline | Pro (P) | Nonpolar, cyclic | 4.7 |
| ACU, ACC, ACA, ACG | Threonine | Thr (T) | Polar, uncharged | 5.1 |
| GCU, GCC, GCA, GCG | Alanine | Ala (A) | Nonpolar, aliphatic | 7.0 |
| UAU, UAC | Tyrosine | Tyr (Y) | Polar, aromatic | 3.2 |
| UAA, UAG, UGA | Stop Codons | — | Translation termination | — |
| CAU, CAC | Histidine | His (H) | Polar, positively charged | 2.3 |
| CAA, CAG | Glutamine | Gln (Q) | Polar, uncharged | 3.9 |
| AAU, AAC | Asparagine | Asn (N) | Polar, uncharged | 4.1 |
| AAA, AAG | Lysine | Lys (K) | Polar, positively charged | 5.9 |
| GAU, GAC | Aspartic Acid | Asp (D) | Polar, negatively charged | 5.3 |
| GAA, GAG | Glutamic Acid | Glu (E) | Polar, negatively charged | 6.2 |
| UGU, UGC | Cysteine | Cys (C) | Polar, sulfur-containing | 1.4 |
| UGG | Tryptophan | Trp (W) | Nonpolar, aromatic | 1.3 |
| CGU, CGC, CGA, CGG, AGA, AGG | Arginine | Arg (R) | Polar, positively charged | 5.1 |
| GGU, GGC, GGA, GGG | Glycine | Gly (G) | Nonpolar, aliphatic | 7.2 |
Key Formulas for Codon and Translated Protein Calculations
Translating a nucleotide sequence into a protein sequence involves several computational steps and formulas. Below are the essential formulas and their explanations.
1. Codon Identification Formula
To extract codons from a nucleotide sequence:
- codoni: The i-th codon in the sequence.
- sequence: The nucleotide sequence (DNA or mRNA).
- 3(i-1) : 3i: Substring indices extracting three nucleotides per codon.
This formula segments the nucleotide string into triplets, each representing a codon.
2. Translation Formula
Mapping codons to amino acids:
- protein: The resulting amino acid sequence.
- n: Number of codons in the sequence.
- AA(codoni): Amino acid corresponding to the i-th codon.
Each codon is translated into its corresponding amino acid using the genetic code table.
3. Reverse Complement Formula (for DNA to mRNA conversion)
When starting from a DNA template strand, the mRNA sequence is the reverse complement:
- reverse_complement(DNA): The sequence obtained by reversing the DNA strand and replacing each nucleotide with its complement.
Complement rules:
- A ↔ U (in RNA), or A ↔ T (in DNA)
- T ↔ A
- C ↔ G
- G ↔ C
4. Protein Molecular Weight Calculation
Estimating the molecular weight (MW) of the translated protein:
- MW: Molecular weight of the protein in Daltons (Da).
- m: Number of amino acids in the protein.
- MW(AAi): Molecular weight of the i-th amino acid residue.
- 18.015: Molecular weight of water (H2O) lost during peptide bond formation.
This formula accounts for the loss of water molecules during peptide bond formation between amino acids.
Detailed Real-World Examples of Codon and Translated Protein Calculations
Example 1: Translating a DNA Sequence to Protein
Given the DNA sequence:
ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
Step 1: Convert DNA to mRNA by replacing T with U:
AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG
Step 2: Segment the mRNA into codons:
- AUG
- GCC
- AUU
- GUA
- AUG
- GGC
- CGC
- UGA
- AAG
- GGU
- GCC
- CGA
- UAG
Step 3: Translate each codon using the codon table:
| Codon | Amino Acid | Abbreviation |
|---|---|---|
| AUG | Methionine (Start) | Met (M) |
| GCC | Alanine | Ala (A) |
| AUU | Isoleucine | Ile (I) |
| GUA | Valine | Val (V) |
| AUG | Methionine | Met (M) |
| GGC | Glycine | Gly (G) |
| CGC | Arginine | Arg (R) |
| UGA | Stop | — |
Step 4: Stop translation at the stop codon UGA.
Resulting protein sequence: M A I V M G R
Example 2: Calculating Molecular Weight of a Protein from Codons
Given the protein sequence from Example 1: MAIVMGR
Step 1: List molecular weights of each amino acid (average residue weights):
| Amino Acid | Abbreviation | Molecular Weight (Da) |
|---|---|---|
| Methionine | Met (M) | 149.21 |
| Alanine | Ala (A) | 89.09 |
| Isoleucine | Ile (I) | 131.17 |
| Valine | Val (V) | 117.15 |
| Methionine | Met (M) | 149.21 |
| Glycine | Gly (G) | 75.07 |
| Arginine | Arg (R) | 174.20 |
Step 2: Sum molecular weights:
Sum = 149.21 + 89.09 + 131.17 + 117.15 + 149.21 + 75.07 + 174.20 = 885.10 Da
Step 3: Calculate water loss due to peptide bonds:
Number of peptide bonds = number of amino acids – 1 = 7 – 1 = 6
Water loss = 6 × 18.015 = 108.09 Da
Step 4: Calculate final molecular weight:
MW = 885.10 – 108.09 = 777.01 Da
Final estimated molecular weight of the protein: 777.01 Daltons
Additional Technical Details and Considerations
- Codon Usage Bias: Different organisms prefer certain codons over others for the same amino acid, affecting translation efficiency. This calculator can incorporate organism-specific codon usage tables for more accurate predictions.
- Start and Stop Codons: Translation initiation typically begins at the start codon (AUG), and terminates at stop codons (UAA, UAG, UGA). The calculator identifies these to define open reading frames (ORFs).
- Reading Frames: There are three possible reading frames per strand. The calculator can analyze all frames to find the correct protein translation.
- Post-Translational Modifications: While the calculator provides primary amino acid sequences, real proteins may undergo modifications affecting molecular weight and function.
- Handling Ambiguous Nucleotides: The calculator can manage ambiguous bases (e.g., N, R, Y) by probabilistic codon assignment or flagging uncertain translations.
Authoritative Resources for Codon and Protein Translation
- NCBI Genetic Codes – Official genetic code tables and translation rules.
- UniProt Codon Usage – Codon usage statistics across species.
- ExPASy Translate Tool – Online tool for nucleotide to protein translation.
- NCBI Protein Database – Repository of protein sequences and annotations.
By integrating these standards and resources, the “Codon and translated protein calculator” ensures precise, reliable, and biologically relevant outputs for researchers and bioinformaticians.